Page 3 (data 61 to 87 of 87) | Displayed ini 30 data/page
<< PREV 1 2 3

61	Topik E: Biodiversity and ecotourism	ABS-33
Hunting Techniques, Production Potential and Wild Bee Host Trees Apis dorsata binghami Budiaman 1 Andi Sadapotto 1 Iswara Gautama 1 Andi Asikin Muchtar 2 Noraeini 3 1Lecturer of Forestry Faculty of Hasanuddin University, Makassar, Indonesia 2 Lecturer of Indonesia Timur University, Makassar, Indonesia 3 Laboratory Assistant of Forest Protection and Insects Laboratory, Faculty of Forestry, Hasanuddin University, Makassar, Indonesia Abstract The wild bee Apis dorsata binghami is a type of bee endemic to Sulawesi which is often hunted and harvested by the community in Boto Lempangan Village, West Sinjai District, Sinjai Regency, which has the potential to produce 50-60 kilograms of honey. and host tree species (bee trees). This research was conducted using the method of observation, interviews and discussions with respondents related to the research, the research respondents were 20 people who were determined by census. The results showed that the community divided their time between hunting and harvesting forest honey, hunting was carried out for several days until they stayed in the forest for 2-3 days with the stages of hunting techniques: surveying, climbing, expelling bees with smoke, harvesting, sorting and packaging. Equipment used when hunting are plastic sheeting, flashlights, machetes, cooking utensils and food ingredients. The peak season for hunting and harvesting is in September - December. Honey production during the peak season reaches 50 kg per harvest, hunter skills also affect yields. Bee hunters have an average of 6-8 years of hunting experience. The preferred types of host trees (bee trees) for nesting by Apis dorsata binghami are Kanunang (Cordia myxa), mango (Mangifera indica), Lita-lita (Alstonio scholaris), Tusam (Pinus merkusi), Paliasa (Kleinhovia hospita), and nutmeg (Myristica fragrans). Keywords: Hunting Techniques, Production Potential, Host Trees and Wild Bees Apis dorsata binghami Share Link | Plain Format | Corresponding Author (Budiaman Budiaman)

62	Topik E: Biodiversity and ecotourism	ABS-34
Species Diversity of Fungi Decomposers of Rhizophora stylosa Leaf Litter in Mangrove Ecosystem Pulau Sembilan Langkat Regency Yunasfi1,2, Y Sihite1 , B Utomo, A Dalimunthe1, S Lestari1, PA Samosir1, MRA Auri1, YI Ramadhan1, A Fadillah 3 and Z Noer4 Universitas Sumatera Utara Abstract Species Diversity of Fungi Decomposers of Rhizophora stylosa Leaf Litter in Mangrove Ecosystem Pulau Sembilan Langkat Regency Yunasfi1,2, Y Sihite1 , B Utomo, A Dalimunthe1, S Lestari1, PA Samosir1, MRA Auri1, YI Ramadhan1, A Fadillah 3 and Z Noer4 1Faculty of Forestry, University Sumatera Utara, Medan, North Sumatera, Indonesia 2Center of Excellence for Mangrove, Universitas Sumatera Utara, Medan 20155, Indonesia 3Faculty of Agriculture, University Sumatera Utara, Medan, North Sumatera, Indonesia 4Faculty of Agriculture, University of Medan Area, Medan, North Sumatera, Indonesia *E-mail: yunasfi@usu.ac.id Abstract. Litter decomposition is a process of decomposing litter which is an important component of the nutrient cycle process because it can contribute greatly to soil fertility. Fungi are one of the microorganisms that play an important role in the decomposition process. The purpose of this study was to identify the number of species and diversity index of fungi, determine the rate of decomposition, and analyze the protein and carbohydrate content of decomposed R. stylosa leaf litter. This research was conducted on Pulau Sembilan, Langkat Regency and at the Forest Cultivation Laboratory, Faculty of Forestry, University of North Sumatra. Carbohydrate and protein analysis was carried out at the Medan Industrial Research and Standardization Center. This research method uses litter bags filled with R. stylosa leaf litter 40 g with 7 treatments, 3 replications. There are 4 species of fungi namely Aspergillus sp, Fusarium sp, Penicillium sp, and Trichoderma sp. The index value of fungal diversity in R. stylosa leaf litter is 1.49. The decomposition rate of R. stylosa leaf litter is 7.7. The highest protein content was found in R. stylosa leaf litter that underwent decomposition for 30 days at 5.76% and the highest carbohydrate content was found in the control at 10.4%. Keys word : Decomposition, fungi, leaf litter, Rhizophora stylosa Keywords: Decomposition, fungi, leaf litter, Rhizophora stylosa Share Link | Plain Format | Corresponding Author (Yunasfi Djayus)

63	Topik E: Biodiversity and ecotourism	ABS-36
Types and potential of phosphate solubilizing fungi in soil under three dominant stands at the Universitas Sumatera Utara campus D Elfiati1,2*, A Susilowati1,2, A B Rangkuti 1,2, M Panjaitan1, F G Dwiyanti3, S H Larekeng4, M Riniarti5 1 Faculty of Forestry, Universitas Sumatera Utara, Medan, Indonesia 2JATI-Sumatran Forestry Analysis Study Centre, Medan, Indonesia 3 Faculty of Forestry, IPB University, Bogor, Indonesia 4 Faculty of Forestry, Universitas Hasanuddin, Makasar, Indonesia 5Faculty of Agriculture, Universitas Lampung, Lampung, Indonesia Abstract Phosphate solubilizing fungi play an important role in helping to increase the availability of phosphorus nutrient in the soil. Phosphorus is one of the essential nutrients for plant growth. The campus of the Universitas Sumatera Utara is planted with various types of trees scattered around the campus. Switenia macrophylla, Mimusops elengi and Polyalthia longifolia are the three most common tree species in the camous area. This study aims to obtain the types and potential of phosphate solubizing fungi found under the stands of the three types of plants. Soil samples were taken compositely in the rhizospehere of plants with a depth 0-20 cm. Isolation of phosphate solubilizing fungi was carried out using Pikovskaya media. The types of phosphate solubilizing fungi was obtained by morphological identification to the genus level, while the potency was measured qualitatively by calculating the phosphate dissolving index. The isolation results obtained a total of 12 isolates of phosphate solubilizing fungi (4 isolates were isolated from each stands). Based on morphological identification, the twelve isolate belong to 2 genera, namely Aspergillus and Penicillium. The results of the calculation of the phosphate dissolution index range from 1.17 to 1.29. Keywords: Mimusops elengi, Phosphate solubilizing fungi, Polyalthia longifolia, Swietenia macrophylla Share Link | Plain Format | Corresponding Author (Deni Elfiati)

64	Topik E: Biodiversity and ecotourism	ABS-37
Morphological Characteristics And Potential Of Acacia Biomass (Acacia Auriculiformis) In The Educational Forests Of Hasanuddin University Iswanto, Muhammad Restu, Mohammad Reza Zulkifli Kariming Faculty of forestry, Hasanuddin University, Makassar Abstract Acacia (Acacia Auriculiformis) is a non-tolerant tree species and has high Biomass potential. This study aimed to determine the morphological characteristics and potential of Acacia Biomass in Hasanuddin University Educational Forest. The samples observed in this study were leaves, stems, and bark, as well as the measurement of the potential of Biomass with Allometric estimation, then further analysis such as correlation analysis and cluster analysis. Based on the results of this study, the morphological characteristics of acacia were obtained with cluster grouping consisting of 2 clusters and further divided into 4 sub-clusters with the highest difference in the sub-clusters found the estimation value of Biomass and Biomass potential in sample P26 and the highest estimated value and Biomass potential were found in P26, the result is 208.71 kg and 5, 42 tons/ha while the lowest was at P5 with the result is 20.93 kg and 0.54 tons/ha. This research shows that is quite high in Acacia stands in Hasanuddin University Educational Forest Keywords: acacia, biomass, morphological Share Link | Plain Format | Corresponding Author (Iswanto Iswanto)

65	Topik E: Biodiversity and ecotourism	ABS-43
Distribution Pattern and Population Structure of Cananga odorata (Lamk) Hook.f.et Th., in Natural Forest of Palanro and Natural Forest of Karaenta Andi Aulia Iswari Syam^un (a), Putu Oka Ngakan (b), Amran Achmad (b), Muhammad Alriefqi Palgunadi (b*) (a) Faculty of Forestry, Hasanuddin University, Indonesia (b) Forest Conservation Study Program, Hasanuddin University, Indonesia Jl. Perintis Kemerdekaan No.KM.10, Tamalanrea Indah, Kec. Tamalanrea, Kota Makassar, Sulawesi Selatan 90245 *muhammad.alriefqi[at]unhas.ac.id Abstract This research aimed to determine the distribution patterns and population structure of Cananga odorata at Natural Forest of Palanro and Natural Forest of Karaenta of Maros Regency. The research was conducted in 6 transect samples located purposixely in the three forest types: secondary natural forest of Palanro, secondary natural forest of Karaenta and primary natural forest of Karaenta. The size of each transect was 20 m x 200 m which each of them divided into unit of 10 m x 10 m. So that, there are 40 units on each transect and the total number of unit was 720 units. Data was collected by measuring the diameter, and coordinate x and y of each individual in every unit, and counting the number of seedling in each unit. Population structure was obtained by counting the total number of cananga at each every growth level and distribution pattern was analyzed using the Morishita distribution index. The research results showed no Cananga odorata was found in secondary forest of Palanro, but Cananga odorata was found in secondary forest and primary forest of Karaenta. The population structure of the Cananga odorata formed almost J shape which indicates that cananga can grow and regenerate in the natural forest of Karaenta because it has abundant number of seedling, as well as sapling and pole levels. Distribution pattern was indicate that the distribution of Cananga odorata is clumped at each growth level. Keywords: Cananga odorata- distribution pattern- population structure Share Link | Plain Format | Corresponding Author (Muhammad Alriefqi Palgunadi)

66	Topik E: Biodiversity and ecotourism	ABS-44
Efectivity of Silkworm Egg Subsidy to Farmer in Soppeng Regency, South Sulawesi, Indonesia Sadapotto, Andi- Armidha, Nirmala- Nuraeni, Sitti Hasanuddin University Abstract Sericulture activity in Soppeng Regency, South Sulawesi, Indonesia has long been a community activity for their livelihood. In recent year, population of sericulture farmer decreased because of many problem. The problem among others silkworm disease, low quality and quantity of cocoon, low price of cocoon, fake/imitation silk. The government of Soppeng Regency then give subsidy in the form of imported silkworm egg from China and also make tourist area named Kampung Sabbeta to draw attention from the tourist. The quantity and quality of cocoon was adequate, but the problem for the farmer was the price of the raw silk still low. The other problem is the fake/imitation silk that resemble with the pure silk with the lower price so the weaver in Wajo Regency prefer to buy raw material from imitation silk. The government of South Sulawesi Province has launched the governor regulation about the labelling of silk yarn and silk product, but the impact has not been feels by the farmer. Keywords: Silkworm Egg, Subsidy, Soppeng Regency, South Sulawesi Share Link | Plain Format | Corresponding Author (Andi Sadapotto)

67	Topik E: Biodiversity and ecotourism	ABS-45
Polymorphism Inter Simple Sequence Repeats (ISSR) Primers for Genetic Diversity for Pooti Plants (Hopea gregaria) Annisa Nur Islami , Muh. Restu, Faisal Danu Tuheteru, Siti Halimah Larekeng, 1Postgraduate Faculty of Forestry, Hasanuddin University, Makassar, Indonesia 2 Faculty of Vocational , Hasanuddin University 3 Faculty of Forestry and Environmental Sciences, Halu Oleo University, Kendari, Southeast Sulawesi. 93121, Indonesia 4 Faculty of Forestry, Hasanuddin University Abstract Pooti (Hopea gregaria) is a medium size tree that can grow up to 35 m from the Dipterocarpaceae family. Since 1998, the International Union for Conservation of Nature (IUCN) has reported the pooti tree as endangered and the species has a narrow distribution, found only in Southeast Sulawesi. One of the efforts to overcome the rarity of the pooti plant is through a tree breeding program. However, this tree breeding program will not be successful without the support of genetic diversity information. The study of genetic diversity can be done using a molecular-based approach using Inter Simple Sequence Repeats (ISSR) markers. Samples of pooti leaves used in the study were taken from Botanical Forest Park Nipa-Nipa (Tahura) and Protected Forest Nanga-Nanga, Kendari City, Southeast Sulawesi Province. A total of 50 samples were extracted using the CTAB (Cetyl Trimethyl Ammonium Bromide) method. Ten types of primers that have been carried out obtained seven primers that can produce bright polymorphic bands and can be continued for study genetic diversity, namely UBC 810, UBC 813, UBC 814, UBC 822, UBC 823, UBC 27, and UBC 830. Keywords: Hopea gregaria, Inter Simple Sequence Repeats , polymorphism Share Link | Plain Format | Corresponding Author (Siti Halimah Larekeng)

68	Topik E: Biodiversity and ecotourism	ABS-47
Reassessment of mud crabs Scylla spp. taxonomic identity in Segara Anakan Lagoon, Cilacap, Indonesia. Arida Fauziyah(a,b,c)*, Marc Kochzius (a), Arni Sholihah (b), Intan Ahmad (b), Angga Dwiartama (b). a = Vrije Universiteit Brussel b = Institut Teknologi Bandung c = Universitas Hasanuddin Abstract Due to high morphological similarity, taxonomic misidentification on the commercially important mud crabs genus Scylla is common. Studies from Segara Anakan Lagoon (SAL) Cilacap mostly recognized Scylla serrata as the only existing mud crabs species in the area. Misidentification of Scylla spp. derived from only using a morphological approach to identify the species. This study aimed to re-assess mud crabs Scylla spp. in SAL using morphometrical analysis, complemented with DNA barcoding. One hundred and seven specimens were collected from SAL in March-June 2021. Fourteen morphometric parameters were measured using a digital vernier caliper (0.01 mm). The DNA barcoding targeted mitochondrial cytochrome oxidase 1 (mtCO1) region, using mtd10 5^TTGATTTTTTGGTCATCCAGAAGT 3^ and C/N 2769 5^ TTAAGTCCTAGAAATGTTRGGGA 3^ paired-end primer set. The Polymerase Chain Reaction (PCR) amplified the region with the protocol used by Rumisha et al. (2018). The Neighbor-Joining Tree (NJT), Non-Metric Multidimensional Scaling (NMDS), and Principal Component Analysis (PCA) showed no clusters of the morphometrical data. In contrast, the mtCO1 sequences revealed that the four species of Scylla spp. were present in SAL, remonstrating previous findings on Scylla spp. presence in the area. Sequences-based NJT clustered four distinct groups of the samples (Bootstrap value= 1000). Each group corresponded to different Barcode Identifier Number (BIN) codes derived from the Barcode of Life Data System (BOLD) during genetic identity verification. The genetic distance (Ds) values between species were higher compared to the within species (0.068-0.173>0.002 to 0.004), confirming there were no cryptic species found in the samples. This study proved that all four Scylla species i.e Scylla serrata, S. olivacea, S. tranquebarica, and S. paramamosain were present in SAL. Additional environmental data such as total organic matter (TOM), Biological Oxygen Demand (BOD), and heavy metal concentration are suggested to support the morphological plasticity assumption. Keywords: Mud crabs, Scylla spp., Segara Anakan Lagoon, Morphometrical analysis, DNA barcoding Share Link | Plain Format | Corresponding Author (Arida Fauziyah)

69	Topik E: Biodiversity and ecotourism	ABS-51
Developing and Testing Specific Primers for PHYA Gene Sequence Analysis in Fourteen Indonesian sorghum varieties Siti Halimah larekeng, Firzan Nainu, Muh. Restu, Ahmad Rifqi Makkasau, Nasri Nasri, Yuni Fitri Cahyaningsih 1. Natural heritage and Biodiversity Research Center Hasanuddin University, Makassar 2. Faculty of Pharmacy, Hasanuddin University, Makassar 3. Faculty of Vocational , Hasanuddin University, Makassar 4. Faculty of Forestry, Hasanuddin University, Makassar 5. National Research and Innovation Agency, Indonesia Abstract Primer is one of the important components needed in the DNA synthesis process using a PCR machine. A specific primer can be developed to amplify the target gene by utilizing Primer3Plus and Python. This study developed specific primers to amplify the PHYA gene using Primer3Plus and compared its amplification rate with primers developed using Python. Sequence Sorghum bicolor phytochrome A (PHYA) gene, (GenBank: AY466073.1) is used as a template to generate the primary sequence. Both methods produced four pairs of primers to amplify the PHYA gene. Both methods were able to produce primers that could amplify the gene in fourteen varieties of sorghum. Each primer tested produces a clear band. The optimum temperature ranges from 51.5 C-57.5 C with PCR-sized products around 950bp. The internet network is needed to be able to design primaries using Primer3Plus while Python can be used without an internet connection but requires the ability to understand Python. Keywords: Clear bands, DNA amplify, Primers, Specific gene Share Link | Plain Format | Corresponding Author (Siti Halimah Larekeng)

70	Topik E: Biodiversity and ecotourism	ABS-52
RESEARCH STATUS OF THREATENED SPECIES DIOSPYROS CELEBICA BAKH. IN INDONESIA: A REVIEW Muhammad Restu, Siti Halimah Larekeng, Dwi Sulastri, Putra Aruri Abdillah Bakri, Margaretta Christita, Julianus Kinho, Rumella Simarmata, Yeni Khairina, Iswanto 1 Faculty of Vocational, Hasanuddin University, Makassar 2 Collaboration Research Center of KARST Microbes 3 Graduate Student. Faculty of Forestry, Hasanuddin University Jl. Perintis Kemerdekaan KM 10, Makassar, South Sulawesi 4 Research Center for Applied Microbiology, National Research and Innovation Agency, Indonesia 5 Research Center for Applied Zoology, National Research and Innovation Agency, Indonesia Abstract Ebony (Diospyros celebica Bakh.) is one of 300 species of Diospyros in the world, only found living and thriving in forest of Sulawesi . Based on (Sunaryo, 2002), 31 species of Diospyros were found growing on the islands of Sulawesi and Maluku and 5 species of which were endemic, namely Diospyros celebica Bakh, Diospyros eburnea Bakh, Diopyros greshoffana Kds ex Bakh, Diospyros polita Bakh, and Diospyros venenosa Bakh. Judging from its level of strength and durability, it is in solid class I and durable class I (Martawijaya et al, 2005). The natural distribution of D. celebica is in the areas of Poso, Donggala, and Parigi (Central Sulawesi), Gowa, Maros, Baru, Sidrap and Luwu (South Sulawesi), Mamuju (West Sulawesi) and Gorontalo which borders Central Sulawesi (Santoso, 2007).The reinforced inclusion of D. celebica as a vulnerable species means that D. celebica is at a high risk of extinction and is very vulnerable to exploitation in the IUCN Red List of Threatened Species in 1988 to overcome the decline in this species^ population. D. celebica can be with the conservation and cultivation of this type. So, this study aims to review the research status of endangered species (Diospyros celebica Bakh.) in Indonesia. Keywords: Diospyros celebica, research status, endangered Share Link | Plain Format | Corresponding Author (Muhammad Restu)

71	Topik E: Biodiversity and ecotourism	ABS-53
Foraging Activities, environmental factors, and Increment Weight of Tetragonula biroi Colonies on beekeeping with Different Hive Materials Andi Prastiyo, Sitti Nuraeni, Budiaman Faculty of Forestry, Hasanuddin University Abstract The Tetragonula biroi is one of the stingless bee species that has many benefits for human life besides producing honey, propolis, and 13 derivative products. Another important service provided by this bee is as a plant pollinator. This research aims to determine the relationship between the foraging activity of T. biroi bees with environmental factors and colony development in hive made of different materials. The study was conducted in Rompegading Village, Maros Regency. This research method used a Completely Randomized Design consisting of four different hive materials, namely glass, triplex, cement, and tree hollows and each treatment was repeated three times. Parameters observed were the number of worker bees leaving and entering the hive throughout the day, colony weight gain, and environmental factors (temperature, humidity, and light intensity). The results showed that the highest foraging activity of worker bees and colony weight gain occurred in natural hive (tree hollows) in the fourth week of observation and the highest artificial hive from cement materials. The peak of bee activity entering and leaving the hive occurred in the morning from 07:00-10:00 and in the late afternoon from 13:00-16:00. In the morning, more bees leave the hive, while more enter in the afternoon. Factors such as temperature, humidity, and light affect the foraging activity of worker bees. Keywords: Activity, Colony weight, Microclimate, Tetragonula biroi. Share Link | Plain Format | Corresponding Author (Andi Prastiyo)

72	Topik E: Biodiversity and ecotourism	ABS-61
GROWTH AND WOOD QUALITY VARIATION OF MAHONI (SWIETENIA MAHAGONI) ON TWO SOCIAL FORESTS IN LAU BAKERI, INDONESIA Nelly Anna, M. Hazarryan, Evalina Herawati Universitas Sumatera Utara Abstract Mahogany (Swietenia mahagoni), belongs to the Meliaceae family. is a fast growing species and is in great demand as a raw material for various wood industries. However, information on growth and wood quality is still limited. This study aims to analyze the growth and estimate the quality of mahogany wood in two community forests in Lau Bakeri. Measurement of growth characteristics was carried out by collecting data (total height, branch-free height, diameter and crown diameter). Estimation of wood quality is done by testing the physical properties of wood, namely (moisture content, specific gravity and density). Sampling by testing the physical properties of wood by census, the number of mahogany trees in Lau Bakeri location 1 was 106 aged 10 years and in location 2 there were 114 aged 9-10 years. The results of growth measurements at the first location Lau Bakeri, average diameter 0.35 m, total height 12 m, branch-free height 3.19 m, crown diameter 4.52 m, moisture content 58.45%, specific gravity 0.56 gr/cm3, density 0.81 gr/cm3. The average results of growth measurements at the second location Lau Bakeri, stem diameter 0.35 m, total height 16.68 m, branch-free height 5.50 m, crown diameter 5.28 m, and physical properties of wood moisture content 58.95 % specific gravity 0.51 gr/cm3, density 0.78 gr/cm3. The growth and quality of wood at each research location varied, the growth characteristics in Lau Bakeri location 1, namely for the total height, had an average of 12 m, a diameter of 35 m, while in Lau Bakeri Location 2, the total height had an average of 16.68 m, the diameter has an average of 35 m, the crown diameter has an average of 5.28 m. While the value of the physical properties of wood in Lau Bakeri location 1, namely for water content has an average of 58.45%, specific gravity has an average of 0.56, density has an average of 0.81 gr/cm3, while in Lau Bakeri location 2 for water content has an average of 58.95%, specific gravity has an average of 0.51, density has an average of 0.78 gr/cm3. Keywords: Growth, wood quality, Swietenia mahagoni, physical properties Share Link | Plain Format | Corresponding Author (Nelly Anna)

73	Topik E: Biodiversity and ecotourism	ABS-62
Chemical characterization and Botanical Source of Stingless Bee Propolis from Sampara District, Konawe Regency, Southeast Sulawesi Niken Pujirahayu (1*), Rosmarlinasiah1, Zakiah Uslinawaty1, Nurhayati Hadjar, Abigael Kabe1 Reza Ichsan Alfandi 1) Department of Forestry, Faculty of Forestry and Environmental Sciences, Halu Oleo University Abstract This study aims to determine the species of stingless bee, chemical composition of propolis and plant sources of stingless bee propolis from Sampara District, Konawe Regency. The study took place from November-December 2021. Propolis samples were taken from nests in the Natural Forest, Sampara District, Konawe Regency. Extraction of propolis samples was carried out at the Forestry Laboratory, FHIL UHO, and the determination of propolis^s chemical components was used to analyze and characterize Gas Chromatography-Mas Spectrometry (GC-MS) at the Chemical Laboratory of the State Polytechnic of Makassar. The results showed that four plants produced resin around the nest and were thought to be the primary source of propolis, namely, Mango (Mangifera indica), Jackfruit (Artocarpus heterophyllus), Kemiri (Aleurites moluccana), and Cassava (Manihot esculenta). The major chemical components of propolis are triterpenes (Cycloartane), (Lupeol) and (9,19-cyclolanost-24-en-3-ol, (3.beta) Keywords: chemical characterization, propolis, botanical source,.Tetragonula sapiens Konawe regencyPlease Just Try to Submit This Sample Abstract Share Link | Plain Format | Corresponding Author (Niken Pujirahayu)

74	Topik E: Biodiversity and ecotourism	ABS-63
Nesting Behavior of Knobed Hornbill (Rhyticeros cassidix): Potential Birdwatching in Bantimurung Bulusaraung National Park Asrianny (a), Chairil (b), A. Subhan (b), Kardiansyah (b) a) Program Study of Forest Conservation, Hasanuddin University, Jl. Perintis Kemerdekaan km 10. Makassar, South Sulawesi 90254 b) Bantimurung Bulusaraung National Park, Jl. Poros Maros -Bone, Maros, South Sulawesi 90561 *asrianny[at]unhas.ac.ic Abstract Knobedd Hornbill (Rhyticeros cassidix) is an endemic species found only on Sulawesi Island. This bird is one of the most interesting species to observe because it is unique, half-shaped, and large compared to other bird species. Therefore, this study aims to provide accurate observation timing and feeding behavior information, which will be a means of interpreting birdwatching in Bantimurung Bulusaraung National Park. Observations were Observations were made of a pair of adults of Knobed Hornbill, which are seen nesting in karst cliffs. Observations of behavior were carried out for 3 days, in July 2023 with direct observation. This study shows routine nesting behavior that is very rare in other bird species. The results showed that parenting patterns were more dominated by male mothers, with the most time allocation being observed from around the nest. Knobed Hornbill is watched through a typical sound. The longest duration to do is standing or moving from one tree to the other right in front of the nest, with the longer duration reaching about 100 minutes. As for the male activity, it takes 3 to 19 minutes to feed the female. Keywords: ecotourism, conservation, protected area Share Link | Plain Format | Corresponding Author (Asrianny Asrianny)

75	Topik E: Biodiversity and ecotourism	ABS-64
Composition and diversity of medicinal plants and their use in agroforestry areas in Bangkeng Buki^ Community Forest on Bukit Harapan Village, Bulukumba Regency Ahmad Rifqi Makkasau(*), Syamsuddin Millang, Rahmatul Jannah Faculty of Forestry Hasanuddin University 90245, Makassar, Indonesia Abstract Medicinal plants and their uses have long been known by the people of Bukit Harapan Village and their use is increasing along with the difficulty of accessing modern medicine. This study aims to determine the composition and diversity of medicinal plant species and their use by the community. This study used direct observation in the field and interviews with respondents by determining the respondents using ^snowball sampling^ in communities that implement agroforestry systems in the Bangkang Buki Community Forest area. The research was conducted from December 2022 to March 2023. The results showed that the composition of plant species on land that applied the agroforestry system found in Bukit Harapan Village totaled 77 types of plants and 40 of them were medicinal plants consisting of 28 types of cultivated plants and 12 wild plant species. The plant species diversity index obtained was 2.72 with the criteria H^ classified as moderate. The percentage of the part of the plant that is used the most by the community is the leaves of 53% and most of the people use medicinal plants in single form and the rest are mixed forms. Keywords: Composition and diversity, agroforestry land, medicinal plants Share Link | Plain Format | Corresponding Author (ahmad rifqi makkasau)

76	Topik E: Biodiversity and ecotourism	ABS-69
Analysis of Cave Potentials as Tourism Object in Developing Specific Interest Tourism at Educational Forest of Hasanuddin University R. S. Tahir (1), R.I. Maulany (2*), A. Achmad (2) 1) Laboratory of Forest Conservation and Ecotourism, Forestry Department, Forestry Faculty, Hasanuddin University, Jalan Perintis Kemerdekaan Km.10, Makassar (South Sulawesi), Indonesia 90245 2) Forest Conservation Department, Forestry Faculty, Hasanuddin University, Jalan Perintis Kemerdekaan Km. 10, Makassar (South Sulawesi), Indonesia 90245 Abstract Cave is one of the morphological forms of Endokarst. The cave is a tunnel formed naturally in rocks which acts as a water channel that connects between the water entry point (sub surface flow) and the exit point. In the Hasanuddin University (Unhas) Teaching Forest Area, a cave was also found which was estimated to be an isolated karst area from the Maros karst cluster which could potentially be used for tourism activities. This study aims to map cave pathway and identify the biophysical potentials (fauna and ornaments) of the cave which could become the main attraction for specific purposes ecotourism in Unhas Teaching Forest. The study was carried out by mapping the cave, inventorying biophysical potencies of the cave and analyzing the cave potencies by using a scoring method. From biophysical potencies identification, 10 types of ornaments were found followed by 26 of fauna species from 6 classes (Arthropods, Mollusca, Mammal, Reptile, Amphibian, and Fish). There were 9 of the 26 fauna species found were categorized as endemic to Maros and Sulawesi. Based on the physical and biological potencies possessed, Bengo-Bengo Cave can be developed as a specific purpose ecotourism object such as cave exploration as the main activity (Adventure Tourism) and observation of cave biota and ornaments (Educational Tourism). Keywords: Karstic Cave, Cave potentials, Specific interest tourism, tourism objects, Educational Forests Share Link | Plain Format | Corresponding Author (Risma Illa Maulany)

77	Topik E: Biodiversity and ecotourism	ABS-70
GROWTH OF TWO LEGUME TREE SPECIES IN BIOPOT INOCULATED BY ARBUSCULA MYCORRHYZA FUNGI (AMF) Retno Prayudyaningsih, Andriyani Prasetyawati, Edi Kurniawan, Laras Murni Rahayu Badan Riset dan Inovasi Nasional Balai Penerapan Standar Instrumen LHK Makassar Balai Pengelolaan Daerah Aliran Sungai Jeneberang dan Walanae Abstract Biopot is a combination of media (organic material) and containers in nursery so it is more efficient and environmentally friendly. Arbuscular mycorrhizal fungi (AMF) are soil microbes that are in symbiosis with plant roots and have been widely proven to be able to accelerate plant growth. The use of biopots and AMF inoculation is expected to produce quality seedlings that are able to survive in the marginal land. This study was conducted to evaluate the effect of AMF inoculation on the growth of seedlings of 2 legume tree species, namely Enterolobium cylocarpum and Leucena leucocephala grown in biopots. The treatments applied were AMF isolates including Acaulospora sp., Gigaspora sp., Glomus sp. a mixture of the three types of AMF, and without AMF inoculation. The results showed that AMF inoculation on L. leucocephala accelerated growth in height, diameter, biomass, and AMF colonization rate compared to plants that were not inoculated with AMF. For E. cylocarpum, AMF inoculation was also able to accelerate growth in height, diameter and AMF colonization level. Meanwhile, the increase in biomass only occurred in seedlings inoculated with Gigaspora sp. and mixed AMF (Acaulospora sp., Gigaspora sp., and Glomus sp.). The type of AMF that produced the best growth increase in L. leucocephala seedlings was Acaulospora sp., while for E. cylocarpum was Gigaspora sp. Eventually, faster seedling growth will shorten nursery time. Meanwhile, the use of biopots as a medium as well as a container for seedlings will streamline time and reduce waste when planting in the field. Keywords: Arbuscular Mycorrhizal Fungi, Biopot, biomass, Enterolobium cylocarpum, Leucena leucocephala, plant growth, marginal land Share Link | Plain Format | Corresponding Author (Retno Prayudyaningsih)

78	Topik E: Biodiversity and ecotourism	ABS-72
High Conservation Value Area for Wildlife Corridor in Forest City Spatial Planning the Indonesia^s New Capital Rustam, Anjar Mulya Faculty of Forestry, Mulawarman University, Samarinda- Nusa Bangsa University, Bogor Abstract An area of lowland tropical forest in East Kalimantan has been designated as an area for the planned State Capital of the Republic of Indonesia (IKN), under the name Nusantara. Covering an area of 256,000 hectares with various land covers and uses, it is planned in such a way for the development of the IKN. The ^forest city^ concept will be applied to this area by maintaining a forested area over 65% of the delineated IKN. The purpose of this study was to identify High Conservation Value Areas (HCV), especially regarding the HCV 1 parameter for important biodiversity and HCV 3 for important ecosystem regions, with the hope of providing input regarding spatial planning for the development of the IKN that is friendly to wildlife habitats and essential ecosystems for wildlife corridor. HCV identification was carried out by spatial analysis using base maps, such as land cover maps, forest area maps, species distribution maps, and important ecosystem maps. These previously mentioned maps were clarified through field visits. The results of this study indicate that at least an area of 887 hectares for north corridor and an area of 5,711 hectares for south corridor is an HCV 1 area with important species such as the Clouded Leopard, Marbled Cat, Sun Bear, and Proboscis Monkey, as well as having identified HCV 3 with essential ecosystems such as lowland forest, karst and mangrove forest. Maintaining HCV areas within the IKN is very important to support the ^forest city^ concept and forest cover. Policies in the spatial planning of the IKN that accommodate HCV areas are very much needed. Keywords: HCV, Forest City, Wildlife, Essential Ecosystem Share Link | Plain Format | Corresponding Author (Rustam Rustam)

79	Topik E: Biodiversity and ecotourism	ABS-74
Foraging Activities, environmental factors, and Increment Weight of Tetragonula biroi Colonies on beekeeping with Different Hive Materials Andi Prastiyo and Sitti Nuraeni Faculty of Forestry Hasanuddin Univesity, Perintis Kemerdekaan Tamalanrea Km10, Makassar, Indonesia. Abstract The Tetragonula biroi is one of the stingless bee species that has many benefits for human life besides producing honey, propolis, and 13 derivative products. Another important service provided by this bee is as a plant pollinator. This research aims to determine the relationship between the foraging activity of T. biroi bees with environmental factors and colony development in hive made of different materials. The study was conducted in Rompegading Village, Maros Regency. This research method used a Completely Randomized Design consisting of four different hive materials, namely glass, triplex, cement, and tree hollows and each treatment was repeated three times. Parameters observed were the number of worker bees leaving and entering the hive throughout the day, colony weight gain, and environmental factors (temperature, humidity, and light intensity). The results showed that the highest foraging activity of worker bees and colony weight gain occurred in natural hive (tree hollows) in the fourth week of observation and the highest artificial hive from cement materials. The peak of bee activity entering and leaving the hive occurred in the morning from 07:00-10:00 and in the late afternoon from 13:00-16:00. In the morning, more bees leave the hive, while more enter in the afternoon. Factors such as temperature, humidity, and light affect the foraging activity of worker bees. Keywords: Activity, colony weight, microclimate Share Link | Plain Format | Corresponding Author (Sitti Nuraeni)

80	Topik E: Biodiversity and ecotourism	ABS-76
Inoculation strategies for agarwood-producing species in Asia: A systematic review Regie Lloren Institute of Agriculture Camiguin Polytechnic State College Purok 2, Tangaro, Catarman, 9104 Camiguin, Philippines Abstract Agarwood is a highly valued non-timber product naturally grown in South and Southeast Asian countries and is a valuable ingredient of incense, perfume, and medicines. It is a highly protected tree species and a lucrative investment for cultivation and production due to its high price. This systematic review aimed to evaluate the different inoculation strategies and examined the available agarwood-producing species in the literature. Further, this review aimed to provide baseline information as a reference for future studies and established research priorities for agarwood studies. Results were obtained from the comprehensive review utilizing the PRISMA framework, where inclusion and exclusion criteria were predefined, and eligibility criteria were established. The published articles were extracted from the Web of Science database of the initial search of 184 records. Articles were screened according to the title, abstract and full text. A total of 37 eligible articles were qualified for review. Data extracted were synthesized and analyzed by vote counting, frequency count, and percentages, as well as figures and tables. Results revealed that the oldest article in the review was from 2005, and the most recent article was from 2022. China was the highest number of publications as of 2022. Among agarwood-producing species, Aquilaria sinenses was the widely utilized specimen for agarwood experiments, while Aquilaria malaccensis was the country-diverse species in the review. Further, fungal inoculation was the most widely used as agarwood inoculation strategy. Finally, this review highlighted the need for further agarwood studies. Keywords: biodiversity, agarwood, inoculation strategies, Aquilaria spp, systematic review Share Link | Plain Format | Corresponding Author (Regie Lloren)

81	Topik E: Biodiversity and ecotourism	ABS-78
STUDY OF THE SPREAD ECOLOGY AND MORPHOLOGY OF SAGO IN PRODUCTION FORESTS IN THE KPHP AREA, SORONG REGENCY (CASE STUDY OF MALAWOR VILLAGE AND KALGULIS VILLAGE, SORONG DISTRICT) Irnawati Irnawati, Muhammad Restu, Agus Rachmat, Siti Halimah Larekeng 1. Postgraduate Student, Faculty of Forestry, Hasanuddin University Jl. Perintis Kemerdekaan KM 10, Makassar, South Sulawesi (90245) 2. Faculty of Vocational, Hasanuddin University Jl. Perintis Kemerdekaan KM 10, Makassar, South Sulawesi (90245) 3. National Research and Innovation Agency, Indonesia 4. Faculty of Forestry, Hasanuddin University Jl. Perintis Kemerdekaan KM 10, Makassar, South Sulawesi (90245) Abstract This study aimed to map and understand the natural distribution area of sago in more detail in the Sorong district. This involves identifying the geographic areas where sago can be found as well as the environmental factors that support its growth which includes an analysis of the climate, such as optimal rainfall, temperature, and humidity for sago. The results showed that the geographical area where sago trees grow varies from valley to coast and has a wet climate with relatively high rainfall, with a range of rainy days every month, namely between 9-27 days. Annual rainfall shows a figure of >2500 mm/year with peat soil types which are none other than organic soils that accumulate in waterlogged areas that have an acidic pH. The potential for trees per Ha is known to be 63.4 trees per clump of 4 Ha of natural sago. In contrast, two types of sago are known, namely Tuni sago (Metroxylon rumphii Martius), the local language with the mention of ^wabilun^ sago, which is very much cultivated by local people with tree species, namely roots tend to be brownish red with root lengths ranging from 60 cm to by 1.5m. Stem height ranges from 7-16 m, with a thickness of bark ranging from 2.5-3 cm. The leaves tend to be bright green, and at the ends or edges of the leaves, there are small thorns on each strand ranging from 1-1.50 m. Compound interest (primary) (one bud) that rises to the top (bud). The spines are found on the stem midribs ranging from 2 -10 cm, found on each leaf midrib, and not so many compared to the rattan sago spines (Metroxylon rumphii Martius). The length of the leaf midrib is in the range of 5-7.2 m, with each leaf midrib having a leaf range of between 100 - 210 leaves (type of frond) for the size of mature sago. Whereas sago thorn rattan (Metroxylon rumphii Martius) with the local language ^Fasenan^ can be seen from the leaf midrib that distinguishes it, namely the red-brown roots with root lengths ranging from 20 cm to 1 m. Stem height ranges from 5-15 m, with a thickness of bark ranging from 3-3.5 cm. The leaves tend to be yellowish green with a leaf pattern that is less dense (rare) with a leaf length ranging from 1-1.30 m. Flowers are almost the same as sago tuni in general, namely with compound interest (primary) (one bud) that rises at the top (bud) at the end of sago when sago is old. The fruit tends to be round and yellowish brown in color, which is found on each fruit stalk which consists of 15-30 fruit in each stalk. Sago thorn rattan tends to have long and many thorns on the stems and midrib of the petiole, so when taking the stalks and leaves, you need to be more careful. The length of the frond ranges from 4-6.3 m, with each leaf midrib having a range of between 30-60 leaves. The distribution pattern of Tuni sago (Metroxylon rumphii Martius) in Malawor village, South Sorong district, is in the category of clustered distribution because Id = 0.973 or less than <1. Furthermore, the distribution pattern of rattan sago thorns (Metroxylon sago Rottbol) in Klagulis village is in the clustered distribution category because Id = 0.791 or less than < 1 so that the large potential of sago tree species found in Sorong district is expected to obtain a better understanding of sago interactions with its environment in an effort to protect and use it wisely. Keywords: Metroxylon, Sorong district, Share Link | Plain Format | Corresponding Author (Muhammad Restu)

82	Topik E: Biodiversity and ecotourism	ABS-86
Local Arbuscular Mycorrhizal Fungi Diversity in Rubber Plants (Hevea brazilian) in Bulukumba with an Agroforestry Pattern Gusmiaty (a*), Nur Padli (a), Muh. Restu (a), Mukrimin (a), Dian Sasmita (a), Syamsuddin Millang (b), Tutik Kuswinanti (c), Muh. Akhsan Akib (d), Syatrawati (e) and Retno Prayudyaningsih (f) (a) Biotechnology and Tree Breeding Laboratory, Faculty of Forestry, Universitas Hasanuddin, Makassar Indonesia *gusmiaty[at]unhas.ac.id (b) Silviculture and Tree Physiology Laboratory, Faculty of Forestry, Universitas Hasanuddin, Makassar Indonesia (c) Departement of Pest and Plant Disease, Faculty of Agriculture, Hasanuddin University, Makassar Indonesia (d) Faculty of Agriculture, Animal Husbandry, and Fisheries, Universitas Muhammadiyah Parepare, Parepare, South Sulawesi, Indonesia (e) Food Crop Production Technology, Pangkep State Polytechnic of Agriculture, Pangkep, South Sulawesi, Indonesia (f) Research Centre for Applied Microbiology, National Research and Innovation Agency (BRIN), Jawa Barat, Indonesia Abstract This research provides a better understanding of the various types of Arbuscular Mycorrhizal Fungi (AMF) associated with agroforestry pattern rubber plantations. By knowing these types, the most suitable AMF species can be processed and selected to increase the productivity of rubber plants. This study aims to explore, identify, and inventory AMF in the rhizosphere of rubber plantations in agroforestry patterns. This research was conducted in March 2023. Soil sampling was carried out in Jojjolo Village, Ballasaraja Village, Bulukumpa District, Bulukumba Regency. Sampling of soil and roots using the method International Centre Research in Agroforestry (ICRAF). Then for the extraction of spores using the wet filter pouring technique and centrifugation technique. The filter results that have been transferred to the petri dish. Spores were observed and counted under a dissecting microscope with 4x magnification. Then transfer the spores based on their morphotype onto filter paper with vertical and horizontal lines in a 0.5 cm x 0.5 cm cup to facilitate observation. The results showed 9 spore morphotypes at 3 density levels. Among them, at rare densities, 954 spores were found with an average of 64 spores per plot. Then at medium density, 952 spores were obtained with an average of 63 spores per plot, and at a dense density, 766 spores were obtained with an average of 51 spores per plot. Keywords: AMF, Spores, Agroforestry, Rubber Plants (Hevea brazilian) Share Link | Plain Format | Corresponding Author (Gusmiaty Gusmiaty)

83	Topik E: Biodiversity and ecotourism	ABS-89
MORPHOPHYSIOLOGICAL ANALYSIS OF Gmelina arborea Roxb IN COMMUNITY FOREST IN BOTOLEMPANGAN VILLAGE, SINJAI BARAT Ananda Afrianti1), Iswanto2), Muhammad Restu3), and Gusmiaty4*) 1,2,3,4Biotechnology and Tree Breeding Laboratory, Faculty of Forestry, Universitas Hasanuddin, Indonesia *gusmiaty[at]unhas.ac.id Abstract Gmelina arborea Roxb is a valuable plant that has great potential in various applications, including the timber industry. This study aims to analyze the morphophysiological aspects of gmelina, but knowledge about the morphophysiological characteristics of this plant is still limited. The data collection method involves direct measurements in the field and the use of special measuring equipment to obtain accurate data. The collected data was analyzed statistically using the appropriate method. This study was conducted by collecting 75 samples of gmelina leaves in the community forest in Botolomenpangan Sinjai Barat Village. Morphological parameters include color, namely, green, light green and spotted green. The shape of the leaves is shaped like a heart (cordate). The shape of the leaf tip is tapered while the shape of the base of the leaf is flat like a straight line (Truncate). The shape of the gmelina leaf edges is jagged and flat. The shape of the gmelina leaf bones is pinnate and the texture of the leaves is smooth and shiny. Physiological parameters starting from the largest chlorophyll content are at the location of taking 2 meters from the soil surface which is equal to 0.03610. The water content in gmelina leaves has the same high value starting from the location of taking the base, middle, and ends which is 9.9774, while the highest leaf area is in gmelina leaves which is 37.21 with the location of taking the base. The results of this study are expected to provide a better understanding of the morphophysiological characteristics of gmelina. This information can be used in a variety of applications, such as plant breeding and increasing wood production. Keywords: Gmelina, morphology, physiology, analysis, characteristics Share Link | Plain Format | Corresponding Author (Ananda Afrianti)

84	Topik E: Biodiversity and ecotourism	ABS-90
Status, Diversity, and Feeding Guilds of Avifauna in the Mining Area Andi Siady Hamzah 1*, Nasri N 1, Andri Ardiansyah 2 1 Faculty of Forestry, Hasanuddin University, Makassar 90245, South Sulawesi, Indonesia- 2 PT Vale Indonesia Tbk, Sorowako, East Luwu 92983, South Sulawesi, Indonesia Abstract Birds contribute to the ecosystem by delivering a variety of ecological services. Birds help the ecology by performing a number of ecological functions. Bird distribution and community structure are determined by specific habitats. The variety and feeding guilds of birds in various land covers were studied at PT. Vale Indonesia^s mining concession. We studied birds^ variety, status, and feeding guilds in three distinct land covers using the point count methods: i) primary dryland forest- ii) secondary dryland forest- and iii) shrubs. Data were obtained from January 20th to February 24th, 2020. There were 38 species from 24 families reported. We discovered 11 Sulawesi endemic species, and 1 vulnerable species. Secondary dryland forest species composition was more similar to primary dryland forest than to shrubs. Carnivores, frugivores, granivores, insectivores, nectarivores, and piscivores make up the fowl. The insectivore bird composition was the highest, while the piscivore bird composition was the lowest. The availability of food supplies and vegetation characteristics may be critical to the diversity of birds in any ecosystem. As a result, this study indicates that land-cover alteration and modification may have an impact on bird diversity structure. Maintaining vegetation as a source of food and habitat for birds is crucial for bird conservation Keywords: Bird diversity, feeding guild, Land cover, Conservation Share Link | Plain Format | Corresponding Author (Andi Siady Hamzah)

85	Topik E: Biodiversity and ecotourism	ABS-92
CHEMICAL COMPOSITION OF BEE BREAD STINGLESS BEES FROM KULISUSU DISTRICT, BUTON UTARA DISTRICT Zakiah Uslinawaty, Niken Pujirahayu, Nurhayati Hadjar, Hendri, Abigael Kabe, Sri Familasari Jurusan Kehutanan dan Ilmu Lingkungan Fakultas Kehutanan dan Ilmu Lingkungan Universitas Halu Oleo Abstract This study aims to determine the chemical composition of stingless bee bread from North Buton. Meanwhile, the purpose of this research is to obtain information on the composition of stingless bee bread and the source of nectar, pollen, from North Buton. The research took place in October-November 2021. Bee Bread samples were taken from beehives in the Forest of North Buton Regency. Determination of the chemical components of Bee Bread Using a spectrophotometer in the Biomedical Laboratory, Faculty of Medicine, Halu Oleo University The results showed that there were two types of stingless bees, namely Tetragonula sapiens and Tetragonula biroi. There are 14 types of plants that have been identified as sources of food for stingless bees. The chemical composition of Bee Bread is that the average protein content of T. sapiens is 27.00% and that of T. biroi is 12%. The average carbohydrate content of T. sapiens is 45.57% and that of T. biroi is 58.11%. On average, the polyphenol content of T. sapiens is 9.88% and that of T. biroi is 22.56%. Keywords: Bee Bread, Stingless bee, Tetragonula sapiens, Tetragonula biroi, North Buton Share Link | Plain Format | Corresponding Author (Zakiah Uslinawaty)

86	Topik E: Biodiversity and ecotourism	ABS-94
Enhanced Rice Germination Using of Bio-humic Solution from Cacao pod Compost with Seed Coating Method Iradhatullah Rahim, Tri Raden, Suherman Universitas Muhammadiyah Parepare Abstract Abstract. The purpose of this study was to identify the optimal bioactivator for rice seed germination. Based on a randomized block design, a factorial design was used to set up the study experimentally. There were two treatments in the study: One of the factors was the availability of seed coating, which could be found in two variants: S1 and S2. Soaking in the bioactivator, which includes soaking the seeds in water or control (B1), Pleurotus sp (B2), and a biohumic solution (B3), is the second factor. The findings demonstrated that the Ciliwung variety of rice seeds germinated more readily after being coated with bio-humic material. Keywords: Germination- seeds, soaking, phytohormones, cacao pod. Share Link | Plain Format | Corresponding Author (Iradhatullah Rahim)

87	Topik E: Biodiversity and ecotourism	ABS-95
Analysis of rate infiltration in community forest Marayoka, Kapita and Gunung Silanu District Nur Herlinda hafid1, Usman Arsyad2, Rizki Amaliah3 1 Student Faculty of Forestry, Hasanuddin University, Makassar, Indonesia 2 Lecture Faculty of Forestry, Hasanuddin University, Makassar, Indonesia 3 Lecture Faculty of Forestry, Hasanuddin University, Makassar, Indonesia Abstract This research aim to determine the infiltration rate in HKM (The social forestry) Marayoka, Kapita and gunung silanu in jeneponto regency. This research was conducted from February to April 2021 for three months. The data collection was done by purposive sampling into account the percentage of the cover ground on the Paine method, after which infiltration measurements were made at the HKM Marayoka,Kapita dan gunung silanu. Also take soil samples to analyze texture, permeability, porosity, organic matter and weight of content in the laboratory. The results showed that the rate of highest infiltration at HKM Marayoka was included in the very fast category while the lowest infiltration rate outside the HKM Marayoka area was included in the medium fast category.This difference is influenced by the physical properties of the soil and cover the ground. Keywords: #infiltration #HKM #jeneponto Share Link | Plain Format | Corresponding Author (Nur herlinda Hafid)

Page 3 (data 61 to 87 of 87) | Displayed ini 30 data/page
<< PREV 1 2 3

Powered By Konfrenzi Ultimate 1.832M-Build6 © 2007-2026 All Rights Reserved