Reassessment of mud crabs Scylla spp. taxonomic identity in Segara Anakan Lagoon, Cilacap, Indonesia.
Arida Fauziyah(a,b,c)*, Marc Kochzius (a), Arni Sholihah (b), Intan Ahmad (b), Angga Dwiartama (b).

a = Vrije Universiteit Brussel
b = Institut Teknologi Bandung
c = Universitas Hasanuddin


Abstract

Due to high morphological similarity, taxonomic misidentification on the commercially important mud crabs genus Scylla is common. Studies from Segara Anakan Lagoon (SAL) Cilacap mostly recognized Scylla serrata as the only existing mud crabs species in the area. Misidentification of Scylla spp. derived from only using a morphological approach to identify the species.

This study aimed to re-assess mud crabs Scylla spp. in SAL using morphometrical analysis, complemented with DNA barcoding. One hundred and seven specimens were collected from SAL in March-June 2021. Fourteen morphometric parameters were measured using a digital vernier caliper (0.01 mm). The DNA barcoding targeted mitochondrial cytochrome oxidase 1 (mtCO1) region, using mtd10 5^TTGATTTTTTGGTCATCCAGAAGT 3^ and C/N 2769 5^ TTAAGTCCTAGAAATGTTRGGGA 3^ paired-end primer set. The Polymerase Chain Reaction (PCR) amplified the region with the protocol used by Rumisha et al. (2018).

The Neighbor-Joining Tree (NJT), Non-Metric Multidimensional Scaling (NMDS), and Principal Component Analysis (PCA) showed no clusters of the morphometrical data. In contrast, the mtCO1 sequences revealed that the four species of Scylla spp. were present in SAL, remonstrating previous findings on Scylla spp. presence in the area. Sequences-based NJT clustered four distinct groups of the samples (Bootstrap value= 1000). Each group corresponded to different Barcode Identifier Number (BIN) codes derived from the Barcode of Life Data System (BOLD) during genetic identity verification. The genetic distance (Ds) values between species were higher compared to the within species (0.068-0.173>0.002 to 0.004), confirming there were no cryptic species found in the samples.

This study proved that all four Scylla species i.e Scylla serrata, S. olivacea, S. tranquebarica, and S. paramamosain were present in SAL. Additional environmental data such as total organic matter (TOM), Biological Oxygen Demand (BOD), and heavy metal concentration are suggested to support the morphological plasticity assumption.

Keywords: Mud crabs, Scylla spp., Segara Anakan Lagoon, Morphometrical analysis, DNA barcoding

Topic: Topik E: Biodiversity and ecotourism

BCTB 2023 Conference | Conference Management System